pAAVscCBPITuDlet-7Gpluc
(Plasmid
#35652)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVscCBPIGpluc
- Backbone size w/o insert (bp) 4734
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTuD let-7
-
SpeciesSynthetic
-
Insert Size (bp)463
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PpuMI (destroyed during cloning)
- 3′ cloning site PpuMI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVscCBPITuDlet-7Gpluc was a gift from Phillip Zamore (Addgene plasmid # 35652 ; http://n2t.net/addgene:35652 ; RRID:Addgene_35652)