Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #35684)

Add to Cart
Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2-Flag-Kdrl-5p-FokI-EL was a gift from Scot Wolfe (Addgene plasmid # 35684)
  • For your References section:

    Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF, Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez AJ, Look AT, Epstein JA, Lawson ND, Wolfe SA. Development. 2011 Oct;138(20):4555-64. 10.1242/dev.066779 PubMed 21937602