1
Browse > Scot Wolfe > Zhu et al > pCS2-Flag-Kdrl-5p-FokI-EL
Plasmid 35684: pCS2-Flag-Kdrl-5p-FokI-EL

  • Kdrl-5p-FokI-EL

  • 864

  • D. rerio (zebrafish)

  • FLAG

  • N terminal on backbone

  • pCS2
    (Search Vector Database)

  • mRNA production

  • 5026

  • KpnI

  • No

  • XbaI

  • No

  • SP6 List of Sequencing Primers

  • ATTAACCCTCACTAAAGGGA

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)

  • Scot Wolfe

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Zhu et al (Development. 2011 Oct;138(20):4555-64. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35684" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only