Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #36182)


Item Catalog # Description Quantity Price (USD)
Plasmid 36182 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Total vector size (bp) 5456
  • Modifications to backbone
    Plasmids peYFP and peCFP were obtained from Clontech. pTOM plasmid, containing eYFP and eCFP, respectively, in 5′ and 3′ of the multi-cloning site was obtained after digestion of peYFP and peCFP by XhoI and HpaI and religation of the eCFP fragment in peYFP. pCalpain-sensor was obtained by digestion of pTOM with BspeI and BamHI and ligation of the following primers: 5′-PCCGGAAGCGGCCAGCAGGAGGTGTATGGTGCGATGCCCAGGGATGGCTCAGGG-3′ and 5′-P-GATCCCCTGAGCCATCCCAGGGCATAGCACCATACACCTCCTGCTGGCCGCTT-3′, which encode the linkers and the mouse α-fodrin cleavage site by ubiquitous calpains. The peptide sequence of the linker and the α-fodrin cleavage site is GSG-QQEVY GAMPRDGSG. GSG corresponds to linker sequences
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    alpha-Fodrin cleavage site
  • Alt name
    calpain sensor
  • Alt name
    EYFP--calpain clevage site from alpha-Fodrin--ECFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Sptan1 (a.k.a. 2610027H02Rik, Spna-2, Spna2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • eYFP (N terminal on insert)
    • eCFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bspe1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-calpainsensor was a gift from Isabelle Richard (Addgene plasmid # 36182 ; ; RRID:Addgene_36182)
  • For your References section:

    Imaging calpain protease activity by multiphoton FRET in living mice. Stockholm D, Bartoli M, Sillon G, Bourg N, Davoust J, Richard I. J Mol Biol. 2005 Feb 11;346(1):215-22. Epub 2004 Dec 16. 10.1016/j.jmb.2004.11.039 PubMed 15663939