Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #36248)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
    pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 6857
  • Modifications to backbone
    PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of promoter CDS cassettes
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

Sequence Information


  • Gene/Insert name
  • Alt name
    Wiskott-Aldrich Syndrome Protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    WAS (a.k.a. IMD2, SCNX, THC, THC1, WASP, WASPA)
  • Promoter MND

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gatcacgagactagcctcgag
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone is from Addgene plasmid 12252 (Didier Trono)
  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL MND WASp was a gift from David Rawlings (Addgene plasmid # 36248)
  • For your References section:

    Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569