1
Plasmid 36248: pRRL MND WASp
  • WASp

  • Wiskott-Aldrich Syndrome Protein

  • 1509

  • H. sapiens (human)

  • WAS (IMD2, SCNX, THC, THC1, WASP)

  • pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
    (Search Vector Database)

  • Didier Trono

  • Lentiviral

  • 6857

  • PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of promoter CDS cassettes

  • MND

  • BamHI

  • No

  • SpeI

  • No

  • gatcacgagactagcctcgag List of Sequencing Primers

  • caacgggccacaactcctc

  • Ampicillin

  • Stbl3

  • 37

  • Low Copy

  • Backbone is from Addgene plasmid 12252 (Didier Trono)

  • View sequences (2)
  • View map

  • David Rawlings

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan et al (Blood. 2012 Mar 19. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36248" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only