(Plasmid #36431)

Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer p10 R: CGGCCAAATGTTAAACTTGGAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC28-10XUAS-IVS-GFP-p10 was a gift from Gerald Rubin (Addgene plasmid # 36431)
  • For your References section:

    Using translational enhancers to increase transgene expression in Drosophila. Pfeiffer BD, Truman JW, Rubin GM. Proc Natl Acad Sci U S A. 2012 Apr 9. 10.1073/pnas.1204520109 PubMed 22493255