Plasmid 36432: pJFRC81-10XUAS-IVS-Syn21-GFP-p10
  • GFP

  • 717

    (Search Vector Database)

  • Insect Expression

  • 8508

  • KpnI

  • No

  • XbaI

  • No

  • hsp70 F: GAGCGCCGGAGTATAAATAGAG List of Sequencing Primers


  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • Gerald Rubin

    Ancillary Agreement for Plasmids Containing FP Materials

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Using translational enhancers to increase transgene expression in Drosophila. Pfeiffer et al (Proc Natl Acad Sci U S A. 2012 Apr 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36432" in your Materials and Methods section.