1
Plasmid 36456: pEGFP-C1-hAtg2A
  • autophagy-related protein 2 homolog A

  • Atg2A

  • 5817

  • H. sapiens (human)

  • NM_015104

  • ATG2A ()

  • EGFP

  • N terminal on insert

  • changed Proline 656 to Arginine

  • pEGFP-C1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4731

  • CMV

  • BglII

  • No

  • BamHI

  • No

  • CGACCACTACCAGCAGAACA List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • View map

  • Noboru Mizushima

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Mammalian Atg2 proteins are essential for autophagosome formation and important for regulation of size and distribution of lipid droplets. Velikkakath et al (Mol Biol Cell. 2012 Mar;23(5):896-909. Epub 2012 Jan 4. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36456" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only