1
Plasmid 37082: pAAV-Ef1a-DO-hChR2(H134R)-mCherry-WPRE-pA
  • hChr2(H134R)-mCherry

  • 1647

  • Synthetic

  • mCherry

  • C terminal on insert

  • pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
    (Search Vector Database)

  • K. Deisseroth Lab

  • rAAV

  • 5613

  • EF1a

  • Asc1

  • Unknown

  • Nhe1

  • Unknown

  • CTTCCATTTCAGGTGTCGTG List of Sequencing Primers

  • GCAGCGTATCCACATAGCG

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • Karl Deisseroth Lab, Stanford Univ.

  • View sequences (3)
  • View map

  • Bernardo Sabatini

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Recurrent network activity drives striatal synaptogenesis. Kozorovitskiy et al (Nature. 2012 May 13;485(7400):646-50. doi: 10.1038/nature11052. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 37082" in your Materials and Methods section.