This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37184)


Item Catalog # Description Quantity Price (USD)
Plasmid 37184 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 4810
  • Vector type
    Mammalian Expression
  • Promoter CAG
  • Tag / Fusion Protein
    • FokI nuclease (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
  • 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The TALEN destination cassette is derived from pTAL4, which is included in the Voytas Lab Golden Gate TALEN Kit.
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

For more information on Pelczar TALEN Add-On Plasmids please refer to:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-T7-TALEN(Sangamo)-Destination was a gift from Pawel Pelczar (Addgene plasmid # 37184)
  • For your References section:

    Mouse genome engineering using designer nucleases. Hermann M, Cermak T, Voytas DF, Pelczar P. J Vis Exp. 2014 Apr 2;(86). doi: 10.3791/50930. 10.3791/50930 PubMed 24747757