-
Purpose(Empty Backbone) Destination vector for Voytas Golden Gate TALEN assembly incorporating a CAG promoter for mammalian expression and a T7 promoter for synthesis of TALEN mRNA. Uses heterodimeric FokI domain (ELD).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 40132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDIRECT
-
Backbone manufacturerCLONTECH
- Backbone size (bp) 4814
-
Vector typeMammalian Expression
- Promoter CAG
-
Tag
/ Fusion Protein
- FokI nuclease (ELD) (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
- 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttg) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe TALEN destination cassette is derived from pTAL4, which is included in the Voytas Lab Golden Gate TALEN Kit. The heterodimeric FokI nuclease, including Q486E, I499L and N496D mutations as well as "Sharkey" mutations S418P and K441E, was derived from Plasmid 37198: pCMV-RosaL6 ELD mutations provided by the Gersbach lab.
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar
Please note that plasmid #40132 is only functional in combination with plasmid #40131.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T7-TALEN(Sangamo)-FokI-ELD-Destination was a gift from Pawel Pelczar (Addgene plasmid # 40132 ; http://n2t.net/addgene:40132 ; RRID:Addgene_40132) -
For your References section:
Mouse genome engineering using designer nucleases. Hermann M, Cermak T, Voytas DF, Pelczar P. J Vis Exp. 2014 Apr 2;(86). doi: 10.3791/50930. 10.3791/50930 PubMed 24747757