pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination
(Plasmid #40131)

• Purpose: (Empty Backbone) Destination vector for Voytas Golden Gate TALEN assembly incorporating a CAG promoter for mammalian expression and a T7 promoter for synthesis of TALEN mRNA. Uses heterodimeric FokI domain (KKR).
• Depositing Lab: Pawel Pelczar
• Publication: Hermann et al J Vis Exp. 2014 Apr 2;(86). doi: 10.3791/50930.

Backbone

• Vector backbone: pDIRECT
• Backbone manufacturer: CLONTECH
• Backbone size (bp): 4814
• Vector type: Mammalian Expression
• Promoter: CAG
• Tag / Fusion Protein:
  • FokI nuclease (KKR) (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: TAL_F1 (ttggcgtcggcaaacagtgg)
• 3′ sequencing primer: TAL_R2 (ggcgacgaggtggtcgttg)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The TALEN destination cassette is derived from pTAL4, which is included in the Voytas Lab Golden Gate TALEN Kit. The heterodimeric FokI nuclease, including I538K, E490K, and H537R mutations as well as "Sharkey" mutations S418P and K441E, was derived from Plasmid 37199: pCMV-RosaR4 KKR mutations provided by the Gersbach lab.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Pelczar TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#pelczar

Please note that plasmid #40131 is only functional in combination with plasmid #40132.