Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

10XSTAT92E–luciferase
(Plasmid #37393)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37393 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUAST
  • Backbone size w/o insert (bp) 8904
  • Vector type
    Insect Expression, Luciferase ; JAK/STAT reporter construct

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SOCS36E enhancer fragment
  • Alt name
    10X STAT92E binding sites
  • Alt name
    JAK/STAT reporter construct
  • Alt name
    SOCS36E
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    Socs36E (a.k.a. Dmel_CG15154, CG15154, Dmel\CG15154, SOCS, SOCS36E, Socs, anon-EST:Liang-2.2, clone 2.2, dSOCS, dmSocs36E, socs36E, socs60E1)
  • Promoter Hsp70

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site multiple (see below for details) (unknown if destroyed)
  • 3′ cloning site multiple (see below for details) (unknown if destroyed)
  • 5′ sequencing primer pUAST-5 (5'-CTGCAACTAAAATCTGCCAAGAAG-3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Perrimon Lab plasmid #446

A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI).

Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E.

Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This
hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70.

Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    10XSTAT92E–luciferase was a gift from Norbert Perrimon (Addgene plasmid # 37393 ; http://n2t.net/addgene:37393 ; RRID:Addgene_37393)
  • For your References section:

    Genome-wide RNAi analysis of JAK/STAT signaling components in Drosophila. Baeg GH, Zhou R, Perrimon N. Genes Dev. 2005 Aug 15;19(16):1861-70. Epub 2005 Jul 29. 10.1101/gad.1320705 PubMed 16055650