Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAc-sgRNA-Cas9
(Plasmid #49330)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49330 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAc-STABLE1-Puro
  • Backbone manufacturer
    Dr. James Sutherland
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 10658
  • Vector type
    Insect Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    CRISPR associated 9
  • Alt name
    hspCas9
  • Species
    Synthetic; Streptococcus pyogenes
  • Insert Size (bp)
    4278
  • Mutation
    Human codon optimised
  • Promoter Actin-5c
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gagttcttgtgctgtgtgga
  • 3′ sequencing primer tcgagacaaacggcgaaacc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dU6-sgRNA
  • Species
    D. melanogaster (fly), Synthetic
  • Insert Size (bp)
    500
  • Promoter Drosophila U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer AAAAAAGCACCGACTCGGTGC
  • 3′ sequencing primer GTTCGACTTGCAGCCTGAAATACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The human codon optimised spCas9 gene was amplified from pX330 (Addgene plasmid 42230) deposited by Feng Zhang. The pAc-STABLE1-Puro plasmid was obtained from Dr James Sutherland.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are mismatches in actin promoter region. Plasmid should be fine.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc-sgRNA-Cas9 was a gift from Ji-Long Liu (Addgene plasmid # 49330 ; http://n2t.net/addgene:49330 ; RRID:Addgene_49330)
  • For your References section:

    Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Bassett AR, Tibbit C, Ponting CP, Liu JL. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120. 10.1242/bio.20137120 PubMed 24326186