ss-cfSGFP2
(Plasmid
#37535)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4105
- Total vector size (bp) 4825
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namess-cfSGFP2 (cysteine-free SGFP2)
-
Alt namecfSGFP2 with a signal sequence of a1-antitrypsin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)873
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- signal sequence of α1-antitrypsin (M1-K34) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCAGAGCTGGTTTAGTGAACCGTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is used for expression of cfSGFP2 in the ER. The cleaved signal sequence of α1-antitrypsin (M1-K34) was fused to the N-terminus of SGFP2 using BglII and EcoRI sites. The fragment M1-A24 should be removed cotranslationally after translocation. The long flanking sequence E25-K34 of α1-antitrypsin was included to ensure access to signal peptidase
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ss-cfSGFP2 was a gift from Ikuo Wada (Addgene plasmid # 37535 ; http://n2t.net/addgene:37535 ; RRID:Addgene_37535) -
For your References section:
Development of cysteine-free fluorescent proteins for the oxidative environment. Suzuki T, Arai S, Takeuchi M, Sakurai C, Ebana H, Higashi T, Hashimoto H, Hatsuzawa K, Wada I. PLoS One. 2012;7(5):e37551. Epub 2012 May 23. 10.1371/journal.pone.0037551 PubMed 22649538