1
Plasmid 37535: ss-cfSGFP2
  • ss-cfSGFP2

  • cfSGFP2 with a signal sequence of a1-antitrypsin

  • 873

  • H. sapiens (human)

  • NM_000295

  • Amino

  • N terminal on insert

  • deleted amino acids 35-432

  • pEGFP-N1
    (Search Vector Database)

  • Clonetech

  • Mammalian Expression

  • 4105

  • CMV

  • BglII

  • No

  • EcoRI

  • No

  • GCAGAGCTGGTTTAGTGAACCGTCAG List of Sequencing Primers

  • Kanamycin

  • XL10 Gold

  • 37

  • High Copy

  • Neomycin

  • View sequences (2)
  • View map

  • Ikuo Wada

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Development of cysteine-free fluorescent proteins for the oxidative environment. Suzuki et al (PLoS One. 2012;7(5):e37551. Epub 2012 May 23. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 37535" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with