This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Hsp68-LacZ-Gateway
(Plasmid #37843)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37843 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer CTCAGTTTGGATGTTCCTGGAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hsp68-LacZ-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37843 ; http://n2t.net/addgene:37843 ; RRID:Addgene_37843)
  • For your References section:

    In vivo enhancer analysis of human conserved non-coding sequences. Pennacchio LA, Ahituv N, Moses AM, Prabhakar S, Nobrega MA, Shoukry M, Minovitsky S, Dubchak I, Holt A, Lewis KD, Plajzer-Frick I, Akiyama J, De Val S, Afzal V, Black BL, Couronne O, Eisen MB, Visel A, Rubin EM. Nature. 2006 Nov 23;444(7118):499-502. Epub 2006 Nov 5. 10.1038/nature05295 PubMed 17086198