-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneNA
-
Vector typeMouse Targeting
- Promoter Mouse Hsp68 minimal promoter
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTGAGCGGATAACAATTTCAC
- 3′ sequencing primer CTCAGTTTGGATGTTCCTGGAG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byJanet Rossant
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hsp68-LacZ-Gateway was a gift from Nadav Ahituv (Addgene plasmid # 37843 ; http://n2t.net/addgene:37843 ; RRID:Addgene_37843) -
For your References section:
In vivo enhancer analysis of human conserved non-coding sequences. Pennacchio LA, Ahituv N, Moses AM, Prabhakar S, Nobrega MA, Shoukry M, Minovitsky S, Dubchak I, Holt A, Lewis KD, Plajzer-Frick I, Akiyama J, De Val S, Afzal V, Black BL, Couronne O, Eisen MB, Visel A, Rubin EM. Nature. 2006 Nov 23;444(7118):499-502. Epub 2006 Nov 5. 10.1038/nature05295 PubMed 17086198