Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #38142)


Item Catalog # Description Quantity Price (USD)
Plasmid 38142 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4651
  • Vector type
    mRNA transcription vector

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Mutation
    Truncate at N and C terminous
  • Promoter T3
  • Tags / Fusion Proteins
    • FokI homodimer (C terminal on insert)
    • AcV5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp31 (destroyed during cloning)
  • 3′ cloning site Esp31 (destroyed during cloning)
  • 5′ sequencing primer CGTGACCGCAATGGAGGC
  • 3′ sequencing primer CACTGCATCCATGGCAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.

The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.

For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).

For more information on Carlson TALEN Add-On Plasmids please refer to:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene plasmid # 38142 ; ; RRID:Addgene_38142)
  • For your References section:

    Efficient TALEN-mediated gene knockout in livestock. Carlson DF, Tan W, Lillico SG, Stverakova D, Proudfoot C, Christian M, Voytas DF, Long CR, Whitelaw CB, Fahrenkrug SC. Proc Natl Acad Sci U S A. 2012 Oct 1. 10.1073/pnas.1211446109 PubMed 23027955