-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZinc finger FYVE domain-containing protein 1
-
Alt nameDFCP1
-
Alt nameZFYVE1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2300
-
GenBank IDNP_898977.2
-
Entrez GeneZfyve1 (a.k.a. DFCP1, G630053K23, TAFF1, ZNFN2A1, mKIAA1589)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIMAGE clone 6848683
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid # 38269 ; http://n2t.net/addgene:38269 ; RRID:Addgene_38269) -
For your References section:
Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694