-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWD repeat domain phosphoinositide-interacting protein 1
-
Alt nameWIPI-1
-
Alt nameWIPI49
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1300
-
GenBank IDAK000917
-
Entrez GeneWIPI1 (a.k.a. ATG18, ATG18A, WIPI49)
-
Tag
/ Fusion Protein
- 3xHA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer AAAATTAGTCAGCCATGGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro HA-WIPI-1 was a gift from Noboru Mizushima (Addgene plasmid # 38273 ; http://n2t.net/addgene:38273 ; RRID:Addgene_38273) -
For your References section:
Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694
Map uploaded by the depositor.