This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMCP-Luc (MCP-1 promoter in pGL3-basic)
(Plasmid #40324)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 40324 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6018
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    MCP-1 promoter
  • Alt name
    macrophage chemoattractant protein-1 promoter
  • Alt name
    CCL2 promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site
  • GenBank ID
  • Promoter MCP-1
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (unknown if destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer LucNrev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:

5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)

5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)

The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:



and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. MCP-1 promoter sequence was verified by sequencing.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCP-Luc (MCP-1 promoter in pGL3-basic) was a gift from Alexander Dent (Addgene plasmid # 40324 ; ; RRID:Addgene_40324)
  • For your References section:

    BCL-6 regulates chemokine gene transcription in macrophages. Toney LM, Cattoretti G, Graf JA, Merghoub T, Pandolfi PP, Dalla-Favera R, Ye BH, Dent AL. Nat Immunol. 2000 Sep;1(3):214-20. 10.1038/79749 PubMed 10973278