Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PBS/pU6- HIF1 alpha RNAi plasmid 1
(Plasmid #21103)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21103 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PBS/U6
  • Backbone size w/o insert (bp) 3300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNAi against hypoxia inducible factor 1alpha
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    70

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site APAI (not destroyed)
  • 3′ cloning site ECORI (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PBS/pU6- HIF1 alpha RNAi plasmid 1 was a gift from Connie Cepko (Addgene plasmid # 21103 ; http://n2t.net/addgene:21103 ; RRID:Addgene_21103)
  • For your References section:

    HDAC4 regulates neuronal survival in normal and diseased retinas. Chen B, Cepko CL. Science. 2009 Jan 9. 323(5911):256-9. 10.1126/science.1166226 PubMed 19131628