-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 21103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePBS/U6
- Backbone size w/o insert (bp) 3300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNAi against hypoxia inducible factor 1alpha
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site APAI (not destroyed)
- 3′ cloning site ECORI (not destroyed)
- 5′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBS/pU6- HIF1 alpha RNAi plasmid 1 was a gift from Connie Cepko (Addgene plasmid # 21103 ; http://n2t.net/addgene:21103 ; RRID:Addgene_21103) -
For your References section:
HDAC4 regulates neuronal survival in normal and diseased retinas. Chen B, Cepko CL. Science. 2009 Jan 9. 323(5911):256-9. 10.1126/science.1166226 PubMed 19131628