pET-Sangamo-HIS
(Plasmid
#40787)
-
Purposefor e. coli expression, Golden Gate Compatible TALEN incorporated with C Terminal 6xHIS Tag, Codon Optimized FokI
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28b
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 3890
- Total vector size (bp) 5838
-
Modifications to backboneAddition of TALEN with +63 C Terminus and FokI Endonuclease. Includes 6xHis tag on C terminal of insert
-
Vector typeBacterial Expression, TALEN
-
Selectable markersXGAL/IPTG
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB + Antibiotics
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTranscription Activator Like Effector Nuclease
-
Alt nameTALEN
-
SpeciesXanthamonas oryzae
-
Insert Size (bp)1948
-
Mutation+63 C Terminus,Codon Optimized FokI Endonuclease
- Promoter T7
-
Tag
/ Fusion Protein
- C Terminal 6xHIS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
- 3′ sequencing primer CGTCCACCAAGACATGCCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 40787" in your Materials and Methods section.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Sangamo-HIS was a gift from Gang Bao (Addgene plasmid # 40787 ; http://n2t.net/addgene:40787 ; RRID:Addgene_40787)