Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3-GI-ZFP2
(Plasmid #42215)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42215 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5334
  • Total vector size (bp) 9276
  • Modifications to backbone
    ZFP2 was inserted into the GI-ZFP1 plasmid using the NotI and XbaI sites to create the GI-FLAG-ZFP2 gene. The FLAG tag was then inserted using the NotI site.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GIGANTEA-FLAG-ZFP2
  • Alt name
    GI-FLAG-ZFP2
  • Alt name
    GI-ZFP2
  • Alt name
    GI
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    3942
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ATTGACGCAAATGGGCGGTAGGCGTGT
  • 3′ sequencing primer GCC TGC TAT TGT CTT CCC AAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-GI-ZFP2 was a gift from Charles Gersbach (Addgene plasmid # 42215 ; http://n2t.net/addgene:42215 ; RRID:Addgene_42215)
  • For your References section:

    Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors. Polstein LR, Gersbach CA. J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27. 10.1021/ja3065667 PubMed 22963237