-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 42215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5334
- Total vector size (bp) 9276
-
Modifications to backboneZFP2 was inserted into the GI-ZFP1 plasmid using the NotI and XbaI sites to create the GI-FLAG-ZFP2 gene. The FLAG tag was then inserted using the NotI site.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGIGANTEA-FLAG-ZFP2
-
Alt nameGI-FLAG-ZFP2
-
Alt nameGI-ZFP2
-
Alt nameGI
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)3942
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ATTGACGCAAATGGGCGGTAGGCGTGT
- 3′ sequencing primer GCC TGC TAT TGT CTT CCC AAT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-GI-ZFP2 was a gift from Charles Gersbach (Addgene plasmid # 42215 ; http://n2t.net/addgene:42215 ; RRID:Addgene_42215) -
For your References section:
Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors. Polstein LR, Gersbach CA. J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27. 10.1021/ja3065667 PubMed 22963237