pHEX2 T494 TALENs
(Plasmid #44464)

• Depositing Labs: Roger Hellens, Ross Johnson
• Publication: Plasmids to assay for nuclease cleavage in planta (unpublished)

Backbone

• Vector backbone: pHEX2
• Backbone size w/o insert (bp): 13812
• Total vector size (bp): 21391
• Vector type: Plant Transformation
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AtCRU3 T494 TALENs
• Alt name: Arabidopsis thaliana CRUCIFERIN 3 gene Target 494 TALENs
• Species: Synthetic
• Insert Size (bp): 7549
• Promoter: CaMV 35S

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
• 3′ sequencing primer: m13 Forward

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The gene was custom-made, but includes sequence from pZHY013 from Zhang et al. 2012
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pZHY013 reference:
Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF (2012) TALENs enable efficient plant genome engineering. Plant Physiology. doi:10.1104/pp.112.205179

Please refer to the references provided below for matters relating to ownership of pHEX2 for anything other than academic use.

pHEX2 reference:
Hellens R, Allan A, Friel E, Bolitho K, Grafton K, Templeton M, Karunairetnam S, Gleave A, Laing W (2005) Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1 (1):13. doi:10.1186/1746-4811-1-13

pART27 (used to derive pHEX2) reference:
Gleave AP (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol Biol 20:1203-1207