pGreenII Tfs-494::LUC
(Plasmid
#44467)
-
PurposeExpresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGreenII 0579-1 (35S:: LUC)
- Backbone size w/o insert (bp) 5549
- Total vector size (bp) 5625
-
Vector typeLuciferase ; Plant Transformation
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
-
Alt nameTfs-494::LUC
-
Alt name(+1) TALEN 494 0579-1
-
Insert Size (bp)76
-
MutationA disruption was made between the first and second triplet of the luciferase gene
- Promoter 35S Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
- 3′ sequencing primer RAJ-365 (CCAGGAACCAGGGCGTATCTC) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGreenII Tfs-494::LUC was a gift from Roger Hellens & Ross Johnson (Addgene plasmid # 44467 ; http://n2t.net/addgene:44467 ; RRID:Addgene_44467)