Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBa.NgCam.GFP
(Plasmid #45061)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6755
  • Total vector size (bp) 10579
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NgCam
  • Alt name
    Neuron-glia cell adhesion molecule (Ng-CAM)
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    3839
  • GenBank ID
    Z75013
  • Entrez Gene
    L1CAM
  • Promoter Chicken Beta Actin
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NgCam received from Peter Sonderegger

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NgCam is very GC rich and difficult to sequence and PCR.

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

Addgene's sequencing results found a few nucleotide differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositor, these differences are not a concern for the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa.NgCam.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45061 ; http://n2t.net/addgene:45061 ; RRID:Addgene_45061)
  • For your References section:

    The role of selective transport in neuronal protein sorting. Burack MA, Silverman MA, Banker G. Neuron. 2000 May;26(2):465-72. 10.1016/S0896-6273(00)81178-2 PubMed 10839364