pBLIC-neo
(Plasmid
#45198)
-
Purpose(Empty Backbone) a ligation-independent cloning (LIC) retroviral vector for stable gene transduction in mammalian cells. Neo selection.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBABE
- Backbone size (bp) 5320
-
Modifications to backboneLigation-independent cloning (LIC) adaptor added to pBABE cloning site: GCACACCATCTCACGTGGAATGTGAG CGTGTGGTAGAGTGCACCTTACACTC
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pBABE 5'
- 3′ sequencing primer pBABE 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLIC-neo was a gift from Priyamvada Rai (Addgene plasmid # 45198 ; http://n2t.net/addgene:45198 ; RRID:Addgene_45198) -
For your References section:
Creation and validation of a ligation-independent cloning (LIC) retroviral vector for stable gene transduction in mammalian cells. Patel A, Munoz A, Halvorsen K, Rai P. BMC Biotechnol. 2012 Jan 16;12:3. doi: 10.1186/1472-6750-12-3. 10.1186/1472-6750-12-3 PubMed 22248071
Map uploaded by the depositor.