Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46004)


Item Catalog # Description Quantity Price (USD)
Plasmid 46004 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5047
  • Total vector size (bp) 5108
  • Modifications to backbone
    Inserted L3S2P21 terminator between the EcoRI and SpeI sites.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    L3S2P21 Terminator
  • Species
  • Insert Size (bp)
  • Promoter PBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gtccacacaatctgcccttt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGR-L3S2P21 was a gift from Christopher Voigt (Addgene plasmid # 46004 ; ; RRID:Addgene_46004)
  • For your References section:

    Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Chen YJ, Liu P, Nielsen AA, Brophy JA, Clancy K, Peterson T, Voigt CA. Nat Methods. 2013 Jun 2. doi: 10.1038/nmeth.2515. 10.1038/nmeth.2515 PubMed 23727987