This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46021)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 46021 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pcDNA3.1 (-)
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6854
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The vector of the CMV-mito-R-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid # 46021)
  • For your References section:

    Improved Orange and Red Ca Indicators and Photophysical Considerations for Optogenetic Applications. Wu J, Liu L, Matsuda T, Zhao Y, Rebane A, Drobizhev M, Chang YF, Araki S, Arai Y, March K, Hughes TE, Sagou K, Miyata T, Nagai T, Li WH, Campbell RE. ACS Chem Neurosci. 2013 Mar 19. 10.1021/cn400012b PubMed 23452507