CMV-mito-LAR-GECO1.2
(Plasmid #61245)

• Purpose: Expresses LAR-GECO1.2 in the mitochondria in mammalian cells
• Depositing Lab: Robert Campbell
• Publication: Wu et al Biochem J. 2014 Nov 15;464(1):13-22. doi: 10.1042/BJ20140931.

Backbone

• Vector backbone: pcDNA3.1 (-)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 6854
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LAR-GECO1.2
• Alt name: low affinity red intensiometric genetically encoded Ca2+-indicators for optical version 1.2
• Species: Synthetic
• Insert Size (bp): 1254
• Mutation: Substitutions relative to R-GECO1.2: N45I/A47R/E138V/K324E
• GenBank ID: KP091741
• Promoter: CMV
• Tag / Fusion Protein:
  • a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The construct is numbered based on GCaMP.