pTK168_mCherry-H2B
(Plasmid #46363)

• Purpose: visualizes chromosomes
• Depositing Lab: Iain Cheeseman
• Publication: Cheeseman Lab pTK plasmids (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	46363	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pBABE
  (Search Vector Database)
• Total vector size (bp): 6542
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: H2B
• Species: H. sapiens (human)
• Insert Size (bp): 400
• Mutation: D26G, V119I and S125D
• Entrez Gene: H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
• Promoter: pBABE
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Terms and Licenses:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry