Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46956)


Item Catalog # Description Quantity Price (USD)
Plasmid 46956 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 4766
  • Modifications to backbone
    Inserted a FLAG tag and XhoI and NotI unique restriction sites between BglII and HindIII.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
    FLAG tag
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-FLAG was a gift from Steve Jackson (Addgene plasmid # 46956 ; ; RRID:Addgene_46956)
  • For your References section:

    A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892