-
PurposePlasmid for expression of GFP-FLAG tagged human Ku80 (N-terminal tag). Confers resistance to G418.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 46958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1-FLAG
- Backbone size w/o insert (bp) 4766
- Total vector size (bp) 6912
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKu80
-
Alt nameXRCC5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2199
-
GenBank IDNM_021141.3
-
Entrez GeneXRCC5 (a.k.a. KARP-1, KARP1, KU80, KUB2, Ku86, NFIV)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
The depositor notes that the D158G point mutation does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-FLAG-Ku80 was a gift from Steve Jackson (Addgene plasmid # 46958 ; http://n2t.net/addgene:46958 ; RRID:Addgene_46958) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892