Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUC gRNA Shuttle
(Plasmid #47024)


Item Catalog # Description Quantity Price (USD)
Plasmid 47024 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2691
  • Total vector size (bp) 3142
  • Modifications to backbone
    The original pUC19 MCS modified to include I-PpoI recognition site. Some restriction sites removed.
  • Vector type
    Plant Expression, CRISPR ; Cas9

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    gRNA Shuttle
  • Species
    Synthetic; Medicago truncatula
  • Insert Size (bp)
  • Mutation
    G to T cloning mutation at position 323
  • Promoter Medicago truncatula U6.6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-PpoI (not destroyed)
  • 3′ cloning site I-PpoI (not destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
  • 3′ sequencing primer GTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC gRNA Shuttle was a gift from Wayne Parrott (Addgene plasmid # 47024 ; ; RRID:Addgene_47024)
  • For your References section:

    Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. . BMC Biotechnology. 2015;15:16 10.1186/s12896-015-0131-2