This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p201B Cas9
(Plasmid #59177)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59177 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPZP
  • Backbone size w/o insert (bp) 6200
  • Total vector size (bp) 13793
  • Modifications to backbone
    Inclusion of aph gene for bacterial selection on kanamycin.
  • Vector type
    CRISPR
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    Cas9 human-codon optimized
  • Species
    Synthetic
  • Insert Size (bp)
    5265
  • Promoter 2x35S

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-SceI (not destroyed)
  • 3′ cloning site I-SceI (not destroyed)
  • 5′ sequencing primer GCTGTGGCGATCGGTATTGC
  • 3′ sequencing primer TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BAR
  • Alt name
    basta resistance
  • Species
    Streptomyces
  • Insert Size (bp)
    1650
  • Promoter 2x35S

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer AGACGTACACGGTCGACTCG
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p201B Cas9 was a gift from Wayne Parrott (Addgene plasmid # 59177 ; http://n2t.net/addgene:59177 ; RRID:Addgene_59177)
  • For your References section:

    Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. . BMC Biotechnology. 2015;15:16 10.1186/s12896-015-0131-2