This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDD162 (Peft-3::Cas9 + Empty sgRNA)
(Plasmid #47549)


Item Catalog # Description Quantity Price (USD)
Plasmid 47549 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 8113
  • Modifications to backbone
    Generated from pCFJ601 by replacing the Mos1 transposase with Cas9, then inserting the U6 Promoter::sgRNA gene. Cloning method was Gibson assembly (selected "Ligation Independent Cloning" as a generic description).
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Codon optimized and with synthetic introns for C. elegans
  • Promoter eef-1A.1 (eft-3)
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
  • 3′ sequencing primer gcttgaaaggattttgcatttatc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Empty sgRNA
  • Insert Size (bp)
  • Mutation
    Missing a 19 bp targeting sequence that must be inserted before use to "program" Cas9
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer N/A
  • 3′ sequencing primer ggtgtgaaataccgcacaga
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The vector backbone, pCFJ601, was received from Addgene. The insert was synthesized in our lab.
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

For more information on Goldstein Lab CRISPR Plasmids please refer to:

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549)
  • For your References section:

    Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. 10.1038/nmeth.2641 PubMed 23995389