This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
(Plasmid #47633)


Item Catalog # Description Quantity Price (USD)
Plasmid 47633 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pAAV EF1a DIO
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 5637
  • Modifications to backbone
    inserted a C between lox2722 and NheI restriction site to disrupt a synthetic start codon in the 5'UTR.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    hChR2 (H134R)
  • Alt name
    Channel Rhodopsin 2
  • Species
    C. reinhardtii
  • Mutation
  • GenBank ID
  • Promoter EF1a
  • Tag / Fusion Protein
    • iRFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer EF1a_F1 (5'-CAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer WPRE_R1 (5'ATGAAAGCCATACGGGAAGC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the ORF for iRFP was obtained from Addgene (Plasmid 31857). the ORF for hChR2H134R) was from Karl Deisseroth, but is also available from Addgene (Plasmid 20297). the backbone was obtained from Karl Deisseroth, but is also available from Addgene (Plasmid 35507).
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP was a gift from Brandon Harvey (Addgene plasmid # 47633)