Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #49383)


Item Catalog # Description Quantity Price (USD)
Plasmid 49383 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 7350
  • Total vector size (bp) 7368
  • Modifications to backbone
    For cloning oligonucleotides into pmirGLO, bp 7314-7331 were excised (region between PmeI and XbaI).
  • Vector type
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
    Smad family member 4
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    SMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAAGCTGAGTTGGCTGCT
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-Smad4-1719 was a gift from Martine Roussel (Addgene plasmid # 49383 ; ; RRID:Addgene_49383)
  • For your References section:

    Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression. Murphy BL, Obad S, Bihannic L, Ayrault O, Zindy F, Kauppinen S, Roussel MF. Cancer Res. 2013 Oct 21. 10.1158/0008-5472.CAN-13-0927 PubMed 24145352