-
Purposeexpresses Membrane tagged G-CaMP3 in cells expressing Cre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameG-CaMP3
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- MARCKS sequence (MGCCFSKT) (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLOOGER LAb
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: There are some discrepancies between the Addgene quality control sequence and the depositor's full assembled sequence. These differences are not in functionally relevant parts of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CMV-LOXP-stop-LOXP-mG-CaMP3.0 was a gift from David Anderson (Addgene plasmid # 50022 ; http://n2t.net/addgene:50022 ; RRID:Addgene_50022) -
For your References section:
Genetic identification of C fibres that detect massage-like stroking of hairy skin in vivo. Vrontou S, Wong AM, Rau KK, Koerber HR, Anderson DJ. Nature. 2013 Jan 31;493(7434):669-73. doi: 10.1038/nature11810. 10.1038/nature11810 PubMed 23364746