-
PurposepX330 containing sgRNA against mouse Cent1. Positive control for DSB mediated EGFP reconstitution.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCetn1 sgRNA1
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter hU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer tggactatcatatgcttacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehumanized S. pyogenes Cas9
-
Alt nameSpCas9
-
Alt namehSpCas9
-
Alt nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4272
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pCBhProF2 (5'-agggtttaagggatggttgg-3')
- 3′ sequencing primer BGH-rev
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX330 was obtained from Dr. Feng Zhang before distributed by Addgene.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-Cetn1/1 was a gift from Masahito Ikawa (Addgene plasmid # 50718 ; http://n2t.net/addgene:50718 ; RRID:Addgene_50718) -
For your References section:
Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. 10.1038/srep03355 PubMed 24284873