This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51058)


Item Catalog # Description Quantity Price (USD)
Plasmid 51058 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4887
  • Total vector size (bp) 5839
  • Modifications to backbone
    Yeast ADH1 promoter and ADH1 terminator were cloned in between the BamHI and EcoRI site, and RGR-GFP-mHDV gene was inserted inbetween the ADH1 promoter and terminator.
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Yeast ADH1 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCTCGTCATTGTTCTCGTTCC
  • 3′ sequencing primer ACGTATCTACCAACGATTTGACC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS316-RGR-GFP-mHDV was a gift from Yunde Zhao (Addgene plasmid # 51058 ; ; RRID:Addgene_51058)
  • For your References section:

    Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Gao Y, Zhao Y. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. 10.1111/jipb.12152 PubMed 24373158