pGL3Basic_ME.1/ApoEpromoter
(Plasmid #51435)

• Purpose: This plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancer
• Depositing Lab: Sohail Tavazoie
• Publication: ME.1/ME.2 ApoE promoter construct cloned into pGL3 basic vector (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	51435	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pGL3 basic
  (Search Vector Database)
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6517
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ME.1+ApoE promoter -980/+(93 bp.)
• Alt name: ME1 malic enzyme 1
• Species: H. sapiens (human)
• Insert Size (bp): 1699
• Mutation: ME.1 enhancer is fused upstream of ApoE promoter (-980/+93 bp)
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
• Entrez Gene: ME1 (a.k.a. HUMNDME, MES)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA

Resource Information

• Terms and Licenses:
  • UBMTA
  • Luciferase Limited Use Label License