-
PurposeDicistronic vector with EMCV IRES
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGl4.13
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 6208
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEMCV IRES
-
Insert Size (bp)583
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TTCTAGAGCTTATCGATACC
- 3′ sequencing primer TGAAGGAGTCCAGCACGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R5 EMCV was a gift from Vincent Mauro (Addgene plasmid # 51733 ; http://n2t.net/addgene:51733 ; RRID:Addgene_51733) -
For your References section:
Analysis of rRNA processing and translation in mammalian cells using a synthetic 18S rRNA expression system. Burman LG, Mauro VP. Nucleic Acids Res. 2012 Sep;40(16):8085-98. doi: 10.1093/nar/gks530. Epub 2012 Jun 20. 10.1093/nar/gks530 PubMed 22718970