AaHsp70Bb-1696-FFluc
(Plasmid
#52912)
-
PurposeAe aegypti hsp70Bb promoter driving firefly luciferase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4773
- Total vector size (bp) 6650
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAa Hsp70B-1696
-
SpeciesAedes aegypti
-
Insert Size (bp)1872
- Promoter Aa Hsp70B-1696
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer ataggctgtccccagtgcaagt
- 3′ sequencing primer tttcatagcttctgccaaccgaacgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AaHsp70Bb-1696-FFluc was a gift from Zach Adelman (Addgene plasmid # 52912 ; http://n2t.net/addgene:52912 ; RRID:Addgene_52912) -
For your References section:
Identification and characterization of heat shock 70 genes in Aedes aegypti (Diptera: Culicidae). Gross TL, Myles KM, Adelman ZN. J Med Entomol. 2009 May;46(3):496-504. PubMed 19496419