Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #53705)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 53705 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9200
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    CIP2A (a.k.a. KIAA1524, p90)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-CIP2A(partial) was a gift from Edward Chan (Addgene plasmid # 53705 ; ; RRID:Addgene_53705)
  • For your References section:

    Tumor suppressor miR-375 regulates MYC expression via repression of CIP2A coding sequence through multiple miRNA-mRNA interactions. Jung HM, Patel RS, Phillips BL, Wang H, Cohen DM, Reinhold WC, Chang LJ, Yang LJ, Chan EK. Mol Biol Cell. 2013 Jun;24(11):1638-48, S1-7. doi: 10.1091/mbc.E12-12-0891. Epub 2013 Apr 3. 10.1091/mbc.E12-12-0891 PubMed 23552692