Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACλCI
(Plasmid #53730)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53730 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACYC184
  • Backbone manufacturer
    ATCC
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 3185
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB5alpha F'LacIQ
  • Growth instructions
    We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    bacteriophage lambda CI protein
  • Alt name
    λCI
  • Species
    bacteriophage lambda
  • Insert Size (bp)
    710
  • Promoter lac UV5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NA (unknown if destroyed)
  • 3′ cloning site NA (unknown if destroyed)
  • 5′ sequencing primer pAC-cI_F (approx 100bp upstream of NotI site in the pAC-cI vector) 5’ gatcagggatagcggtcagg 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/

Please note the sequence-based map incorrectly shows the insert as "cI857 LR”. This is incorrect-cI857 refers to a temperature sensitive allele of cI, but the gene in the plasmid is wild type.

The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACλCI was a gift from Ann Hochschild (Addgene plasmid # 53730 ; http://n2t.net/addgene:53730 ; RRID:Addgene_53730)
  • For your References section:

    Activation of prokaryotic transcription through arbitrary protein-protein contacts. Dove SL, Joung JK, Hochschild A. Nature. 1997 Apr 10;386(6625):627-30. 10.1038/386627a0 PubMed 9121589