pBRα-σ70 D581G
(Plasmid #53732)

• Purpose: Plpp/PlacUV5- directed synthesis of the alpha NTD fused to E. coli σ70 region 4. Used as two-hybrid control. For cloning purposes, see Addgene plasmid 53734.
• Depositing Lab: Ann Hochschild
• Publication: Dove et al Nature. 1997 Apr 10;386(6625):627-30.

Backbone

• Vector backbone: pBR322
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB5alpha F'LacIQ
• Growth instructions: We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RNAP alpha NTD (aa 1-248) fused to E. coli sigma 70 (aa 528-613)
• Alt name: rpoA-rpoD fusion
• Species: E. coli
• Mutation: The sigma 70 moiety carries the D581G substitution
• Promoter: lpp/lacUV5 (tandem promoter)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NA (unknown if destroyed)
• 3′ cloning site: NA (unknown if destroyed)
• 5′ sequencing primer: pBRa_F (approx 100 bp upstream of hte 3' end of alpha NTD) 5’ gaacagcgtaccgacctggac 3’

Resource Information

• Supplemental Documents:
  • Hochschild_B2H_info
  • Hochschild_B2H_image

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/

The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642