This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #54480)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 54480 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Phil Soriano, Addgene Plasmid #21714
  • Modifications to backbone
    Modified by deleting the HpaI site, converting the XhoI site to AscI, and cloning a splice acceptor-GFP-polyA into the XbaI site. Cre-lox regulated U6 cassette derived from pSICO PGK puro, Addgene plasmid 11586, (Ventura et al., 2004) was modified by replacing the lentiviral GFP gene with drug selection markers (pgk-puro), and cloned into the XbaI site 3' of GFP. Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.
  • Vector type
    Mammalian Expression, Mouse Targeting, RNAi, Cre/Lox
  • Promoter U6
  • Selectable markers
  • Tags / Fusion Proteins
    • SA-EGFP-polyA (N terminal on backbone)
    • U6 promoter (N terminal on backbone)
    • loxP (N terminal on backbone)
    • pgk-puro (N terminal on backbone)
    • loxP (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CRUSH-for CATCAGAAGCTGGTCGACTCT
  • 3′ sequencing primer CRUSH-rev GGGCCACAACTCCTCATAAA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.

Using the primers described above yields 429 bp and 374 bp for positive and negative products, respectively.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRUSH was a gift from Laurie Jackson-Grusby (Addgene plasmid # 54480 ; ; RRID:Addgene_54480)
  • For your References section:

    RUSH and CRUSH: a rapid and conditional RNA interference method in mice. Brown JR, Zetsche B, Jackson-Grusby L. Genesis. 2014 Jan;52(1):39-48. doi: 10.1002/dvg.22718. Epub 2013 Oct 26. 10.1002/dvg.22718 PubMed 24166816