Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMVp-dCas9-3xNLS-VP64 (Construct 1)
(Plasmid #55195)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55195 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGw (Addgene id: 25870)
  • Backbone manufacturer
    Sally Temple
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 13567
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9
  • Alt name
    CRISPR/Cas Type II system
  • Alt name
    mutated Cas9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4416
  • GenBank ID
    KJ796484
  • Promoter CMV/hUBC
  • Tag / Fusion Protein
    • VP64 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAACTATGCGCTCGGGGTTGGCGAG
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    From Addgene (pMJ841)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see http://www.rle.mit.edu/sbg/resources/ for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMVp-dCas9-3xNLS-VP64 (Construct 1) was a gift from Timothy Lu (Addgene plasmid # 55195 ; http://n2t.net/addgene:55195 ; RRID:Addgene_55195)
  • For your References section:

    Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. 10.1016/j.molcel.2014.04.022 PubMed 24837679