-
Purpose(Empty Backbone) lux-reporter vector, integration at sacA, ampr, cmr
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 55172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAH328
-
Backbone manufacturerSchmalisch et al, 2010
-
Vector typeSynthetic Biology ; Bacillus BioBrick Box
- Promoter none
-
Selectable markerschloramphenicol resistance in B. subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
Resource Information
Depositor Comments
Contains the luxABCDE-operon from Photorabdus luminescence with all RBSs adjusted for use in B. subtilis. Allows the measurement of promoter activities based on transcriptional fusions and mediates chloramphenicol resistance. Integrates into the sacA locus.
For sequencing of inserts, use the following primers:
fwd: GAGCGTAGCGAAAAATCC
rev: GAAATGATGCTCCAGTAACC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS3Clux was a gift from Thorsten Mascher (Addgene plasmid # 55172 ; http://n2t.net/addgene:55172 ; RRID:Addgene_55172) -
For your References section:
The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448