Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBS4S
(Plasmid #55170)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55170 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDG1731
  • Backbone manufacturer
    Guerout-Fleury, et al. 1996
  • Modifications to backbone
    The erm-resistance outside of the integrative part of pDG1731 was removed via cut-ligation with MluI and BssHI, resulting in a 4.7 kb vector. The PstI site in bla was removed by site directed mutagenesis. The PstI site in thrB was removed performing site-directed mutagenesis. The spc-promoter with upstream PstI-overhang was amplified and cut with PstI and PciI. The MCS was cut from pSB1C3 with EcoRI and PstI. The vector was cut with EcoRI and PciI and the 4.3 kb-fragment ligated with both cut DNA-fragments. The remaining NgoMIV sites were removed by subsequent site-directed mutagenesis.
  • Vector type
    Synthetic Biology ; Bacillus BioBrick Box
  • Promoter none
  • Selectable markers
    spectinomycin resistance in B. subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme

Resource Information

Depositor Comments

This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: CGCTCAAGCTGTCATGTACG
rev: CGTATGTATTCAAATATATCCTCCTCAC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS4S was a gift from Thorsten Mascher (Addgene plasmid # 55170 ; http://n2t.net/addgene:55170 ; RRID:Addgene_55170)
  • For your References section:

    The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448